Bio Criptoanalisis




Bio Criptoanalisis
o como descrifrar mensajes secretos con potinges raros


        1 .- Introducción.
        2 .- Usando ADN para resolver problemas informáticos.
        3 .- Adleman y el problema de los caminos Halmitonianos.
        4 .- Métodos químicos empleados en buscar la solución.
        5 .- Stickers, o como detectar ceros y unos.
        6 .- Usos del ADN en criptografía.
        7 .- El estado del arte.
        8 .- Bibliografía.

1 .- Introducción.

¿Son seguros los algoritmos de encriptación que estamos usando actualmente?, en un principio, y usando los métodos que tenemos a nuestro alcance, si.

Supongamos que encriptamos un mensaje, con un algoritmo de encriptación de 64 bits, eso significaría que si hicieramos un ataque de fuerza bruta, necesitariamos comprobar en el peor de los casos las 18446744073709551616 combinaciones posibles.

Vamos a suponer que codificando ese algoritmo en ensamblador nos salen unas 30 instrucciones máquina y la CPU tendría que ejecutar unas 553402322211286548480 y suponiendo un ciclo por instrucción y un AMD overcloqueado a 4 GigaHerzios, necesitamos 263.224 años para descrifrar el mensaje, aunque es posible, si tenemos mucha suerte, que lo consigamos en solo 100 años.

Si en lugar de 64 bits, usamos 128 bits, sólo necesitamos 4855627381862705355816960 años, y si usamos 256 bits, la cosa se pone mucho más dura.

Para poder leer un mensaje secreto, necesitamos o bién un sistema extremadamente rápido o bién un sistema extremadamente paralelo.

El sistema extremádamente rápido, es el ordenador cuantico, y todavía hace falta muchos años, para tener un sistema que pueda ser usado en criptoanálisis.

Los sistemas extremadamente paralelos, hay varias formas, usar un gusano de red que robe tiempo de CPU de las máquinas que infecte, montar un sistema parecido al del proyecto SETI o la más reciente: La computación DNA, de la que vamos a hablar en este artículo.

2 .- Usando ADN para resolver problemas informáticos.

¿Se puede usar ADN para resolver problemas informáticos?, y si es así ¿como?, en primer lugar, vamos a repasar brevemente, qué es al ADN y como funciona.

El ADN, se compone de unas moléculas llamadas DNA o nucleotidos estos nucleótidos, se llaman adenina (A), citosina (C), guanina (G) y timina (T). En el mundo de la biología molecular, a los caracteres que se emplean para representar los DNA, "A", "C", "G" y "T" se les llama monómeros.

Dentro del ADN, estos componentes DNA, están unidos entre sí, mediante moléculas de azucar, formando cadenas muy largas, a cada combinación de tres de estos componentes DNA, se le llama "codon".

Estas cadenas, dentro del ADN, no están solas, si no que están unidas mediante puentes de hidrógeno a otra cadena "complementaria". De tal forma que la adenina siempre se vincula con la timina, y la guanina con la citosina.

Si tenemos la cadena ACGCTAGCTA su cadena complementaria sería TGCGATCGAT y por lo tanto, el ADN quedaría de la forma:

 ACGCTAGCTA |||||||||| TGCGATCGAT

También podría ser posible algo como lo siguiente:

 ATAGC || AGCTA 

El ARN, es similar al ADN, salvo que en lugar de tener timina tiene otro componente llamado uracilo (U), que igual que la timina, se une a la adenina. En la naturaleza tiene la misión de hacer de mensajero, para hacer copias de cadenas de ADN.

3 .- Adleman y el problema de los caminos Halmitonianos.

La computación ADN, es una ciencia muy joven, comenzó en 1994 cuando Leonard Adleman publicó "Molecular computation of solutions to combinatorial problems". a partir de ese momento, muchas universidades y laboratorios del mundo empezarón a investigar en ese campo, consiguiendo avances interesantes, muchos de ellos muy recientes.

Leonard Adleman es un científico de la universidad de Carolina del sur, es conocido también por ser uno de los autores del algoritmo RDA, (la letra "A").

Adleman, realizó un experimento que consistía en demostrar que es posible hacer computación de una forma diferente a la tradicional, intentó resolver el problema de los caminos halmitonianos, también conocido como del viajero, usando secuencias de ADN.

Pero, ¿En qué consiste el problema del viajero?

Supongamos, que un viajero, tiene que recorrer N ciudades, estas ciudades, están conectadas mediante caminos, ahora bién, no existen caminos que unan todas las ciudades, y algunos caminos, incluso, pueden ser de un sólo sentido.

El problema del viajero, consiste en recorrer todas las ciudades, eligiendo siempre el camino más corto posible, y sin pasar dos veces por la misma ciudad.

En la medida que se aumenta el número de ciudades, el tiempo necesario para resolver el problema, crece exponencialmente, de tal forma que a partir de N ciudades, (¿1000?), no existe ningún ordenador que sea capaz de resolverlo, salvo que dispongamos de un sistema cuantico, y esos no lo fabrican.

Adleman, eligió un ejemplo sencillo de seis ciudades, y para cada ciudad, codificó una secuencia de ADN distinta. Observe el siguiente grafo que representa 4 ciudades.

 MADRID <------- LONDRES ^ | | BARNA -------> PARIS 

Queremos llegar a Madrid, Partiendo de Barna.

 MADRID ATCGAGC LONDRES GTACGTA PARIS CGTGCGA BARNA TGCCGAA 

Revisamos brevemente las cadenas, para asegurarnos de que no pueden ser combinadas entre si, ¿Y como codificamos los posibles caminos representados en el grafo?,

Sobre el grafo que queramos resolver, representamos para una de las flechas dos secuencias de ADN, una para el origen, y otra para el destino, estas secuencias de ADN, deben ser combinables

Por ejemplo

 MADRID - LONDRES AAA <------ TTT LONDRES - PARIS CCC <------ GGG PARIS - BARNA CAG <------ GTC 

Estas secuencias, que representan los orígenes y destinos, se añaden al origen y al final de las secuencias de ADN que representan las ciudades.

BARNA TGCCGAA + GTC
PARIS CAG + CGTGCGA + GGG
LONDRES CCC + GTACGTA + TTT
MADRID AAA + ATCGAGC 

Observe que cuanto mayor sea el número de ciudades, será necesario usar secuencias de ADN de mayor tamaño para codificar todas las combinaciones necesarias.

Observe también, que si de un pais salieran dos grafos, haría falta crear varias combinaciones DESTINO + CIUDAD + ORIGEN

Por ejemplo, si existiera otro grafo entre PARIS y MADRID, además de lo anterior, tendríamos que codificar.

 MADRID - PARIS CTC <------ GAG 

Y como resultado tendríamos dos secuencias de ADN más:

 MADRID CTC + ATCGAGC PARIS CAG + CGTGCGA + GAG 

Si un grafo es de doble sentido, será necesario, codificarlo dos veces, uno para cada sentido.

Si mezclamos los cuatro tipos de secuencias de ADN, en este ejemplo sólo conseguiríamos dos tipos de resultados posibles:

 TGCCGAAGTC CCCGTACGTATTT ||| ||| ||| CAGCGTGCGAGGG AAAATCGAGC 

 TGCCGAAGTC CTCATCGAGC ||| ||| CAGCGTGCGAGAG 

En este ejemplo, el segundo resultado, no valdría, puesto que hay que recorrer todas las ciudades. Con un ejemplo un poco más complicado conseguiríamos muchísimas combinaciones diferentes de cadenas ADN.

4 .- Métodos químicos empleados en buscar la solución.

En el momento en el que hacemos la mezcla, en poco tiempo, tenemos la solución, probablemente, la tengamos millones de veces, pero ojo: tenemos la solución en el tubo de ensayo.

Ahora hace falta buscar la solución. Esta búsqueda de la solución se hace mediante diversos procedimientos.

En primer lugar, tenemos que quedarnos con todas aquellas cadenas, que comiencen en el nodo de origen, y terminen en el nodo de destino. Para conseguirlo se amplifica el resultado con una reacción de polimerasa, (ARN). A este procedimiento químico se le llama PCR (Polimerase Chain Reaction).

Despues tenemos que quedarnos con las cadenas que tienen exactamente la longitud que queremos, para eso se usa un compuesto llamado "gel agaroso", y se amplifica el resultado mediante varios PCR y purificación.

Por último, tenemos que seleccionar, las cadenas que pasen por cada nodo una sola vez. Por lo que al buffer de soluciones, se le somete a una purificación por afinidad mediante campos magnéticos y finalmense se amplifica por PCR.

Los procesos de PCR, no amplifican todas las soluciones, si no que es preparado antes, para amplificar sólo las cadenas que cumplan ciertas condiciones.

En el experimento, el proceso químico en el que se creó la solución en el tubo de ensayo, duró un segundo, pero la búsqueda de la solución duró una semana de trabajo de laboratorio.

Para mayor información sobre los procesos químicos empleados puede acudir a la sección de bibliografía.

5 .- Stickers, o como detectar ceros y unos.

Pero, la computación DNA, no se limita a la simple resolución de problemas que puedan ser descompuestos en problemas de caminos halmitonianos. También es posible codificar ceros y unos en secuencias de DNA y procesarlos mediante un algoritmo.

En mayo de 1996, el equipo de Adleman, introdujo un nuevo concepto de computación DNA llamado modelo sticker. En ese modelo, usan secuencias de bases DNA para representar los ceros y los unos, usando el mismo ejemplo que usan ellos, tenemos los siguientes conjuntos de bases, llamados M bases, ¿M =Memory?)

 M Bases Stickers --------------------- AGTAT TCATA TAGCC ATCGG CGTGA GCACT 

Podemos crear una cadena tan larga como queramos usando stickers, por ejemplo, la siguiente es una cadena de 12 bits.

 ATCGGTCATAGCACTATCGGTCATAGCACTATCGGTCATAGCACTATCGGTCATAGCACT 0 0 0 0 0 0 0 0 0 0 0 0 

Pero para activar un bit, o sea, representar también a los 1, usamos también las cadenas complementarias. Si quisieramos representar el número 0x3E5, o sea 0011 1110 0101

 CGTGATAGCCAGTATCGTGATAGCC TAGCC CGTGA ||||||||||||||||||||||||| ||||| ||||| ATCGGTCATAGCACTATCGGTCATAGCACTATCGGTCATAGCACTATCGGTCATAGCACT 0 0 1 1 1 1 1 0 0 1 0 1 

Usando cadenas de este tipo, es posible hacer cuatro tipo de operaciones:

1 .- Combinar el contenido de dos tubos en uno.

 TUBO A TUBO RESULTANTE CGTGATAGCC CGTGATAGCC |||||||||| |||||||||| ATCGGTCATAGCACTATCGG ATCGGTCATAGCACTATCGG 0 0 1 1 0 0 1 1 AGTATCGTGATAGCC AGTATCGTGATAGCC ||||||||||||||| ||||||||||||||| TCATAGCACTATCGGTCATA =====> TCATAGCACTATCGGTCATA 1 1 1 0 =====> 1 1 1 0 =====> TUBO B =====> TAGCC CGTGA TAGCC CGTGA ||||| ||||| ||||| ||||| GCACTATCGGTCATAGCACT GCACTATCGGTCATAGCACT 0 1 0 1 0 1 0 1 ATCGGTCATAGCACTATCGG ATCGGTCATAGCACTATCGG 0 0 0 0 0 0 0 0 

2 .- Separar el contenido de un tubo en dos tubos, de forma arbitraria por un bit. En el siguiente ejemplo, vamos a hacer una separación por el bit 1

 TUBO ORIGEN TUBO A CGTGATAGCC |||||||||| ATCGGTCATAGCACTATCGG 0 0 1 1 AGTATCGTGATAGCC AGTATCGTGATAGCC ||||||||||||||| ||||||||||||||| TCATAGCACTATCGGTCATA =====> TCATAGCACTATCGGTCATA 1 1 1 0 =====> 1 1 1 0 =====> =====> TUBO B TAGCC CGTGA TAGCC CGTGA ||||| ||||| ||||| ||||| GCACTATCGGTCATAGCACT GCACTATCGGTCATAGCACT 0 1 0 1 0 1 0 1 ATCGGTCATAGCACTATCGG ATCGGTCATAGCACTATCGG 0 0 0 0 0 0 0 0 CGTGATAGCC |||||||||| ATCGGTCATAGCACTATCGG 0 0 1 1 

3 .- Asignar a 1, el contenido de un bit, para todas las cadenas de un tubo. En el siguiente ejemplo, ponemos a 1, el bit 3 de todas las cadenas del tubo B.

 TAGCC CGTGA TAGCCAGTATCGTGA ||||| ||||| ||||||||||||||| GCACTATCGGTCATAGCACT =====> GCACTATCGGTCATAGCACT 0 1 0 1 =====> 0 1 1 1 =====> ATCGGTCATAGCACTATCGG =====> CGTGA 0 0 0 0 ||||| ATCGGTCATAGCACTATCGG 0 0 1 0 

4 .- Poner a 0, el contenido de un bit, para todas las cadenas de un tubo. En el siguiente ejemplo, ponemos a 0, el bit 3 del tubo A.

 

 CGTGATAGCC TAGCC |||||||||| ||||| ATCGGTCATAGCACTATCGG =====> ATCGGTCATAGCACTATCGG 0 0 1 1 =====> 0 0 0 1 =====> AGTATCGTGATAGCC =====> AGTAT TAGCC ||||||||||||||| ||||| ||||| TCATAGCACTATCGGTCATA TCATAGCACTATCGGTCATA 1 1 1 0 1 1 0 0 

La computación en el modelo sticker, se hace mediante multiples operaciones de mezcla, separación por uno o varios bits, set, y reset por un bit.

La programación, es similar a la programación en ensamblador, pero bastante más dura, sobre todo para los que estamos acostumbrados a lenguajes de alto nivel.

Para el modelo físico del sticker, describieron una serie de tubos de ensayo, tantos como sean necesarios según la complejidad del problema a resolver, manipulados por brazos robot y una serie de cabezales que realicen las operaciones.

Los tubos que dejan de tener datos, han de ser rigurosamente limpiados y esterilizados antes de volverlo a usar en una nueva operación.

Las ventajas del modelo sticker, consiste en que nos ahorramos muchos procesos químicos caros y cuyos componentes no pueden ser reutilizados.

6 .- Usos del ADN en criptografía.

En este documento , he descrito dos formas distintas de hacer computación mediante ADN.

El primer método, que hoy por hoy es una realidad, sólo sirve para resolver problemas que pueden descomponerse en un problema halmitoniano o cuya solución pase por una búsqueda exhaustiva de todas sus posibles soluciones para quedarnos con la mejor, por lo que depende del algoritmo de encriptación utilizado.

En el FAQ de PGP, (ver la sección de bibliografía), hacen referencia a este primer método. Según este FAQ, la computación DNA, sería mucho más apropiada que la computación cuantica para romper encriptaciones, pero se puede evitar usando una llave de suficiente tamaño. Mencionan que para factorizar una llave RSA de 1000 bits, hace falta 10 ^ 120 litros de DNA, (un 1 seguido de 120 ceros). Por lo que aconsejan pasarse a claves de 256 bits.

El documento "On Applying Molecular Computacion To the Data Encryption Standard" del equipo de Adleman, describe un uso para una máquina de tipo sticker, romper el algoritmo DES.

Este algoritmo, ha sido roto usando máquinas electrónicas masivamente paralelas o mediante hartware especial, construido expresamente para esa finalidad, pero se sigue resistiendo a los PCs convencionales. Según mis calculos, para un PC de 4 Gigaherzios harían falta 1028 años, en el peor de los casos, (suponiendo que ejecutaramos 30 instrucciones de ensamblador por cada prueba).

La máquina de procesamiento DNA, la describen como una estación de trabajo robótica paralela, donde hay un rack de tubos de datos, tubos stickers y tubos de procesamiento, algunos robots y procesadores que controlan a los robots.

Las operaciones que puede hacer esta máquina son:

- Separación paralela. Separan los datos de 32 tubos, usando 32 tubos operadores en 64 tubos al mismo tiempo. El tubo operador que se emplea es el llamado "separation operator", la separación se hace mediante el valor de un bit, por eso existen diferentes "separation operator" preparados para separar por diferentes bits.

- Agrupación paralela. Con la ayuda del tubo "blank operator", se unifica el contenido de 64 tubos en un sólo tubo de datos.

- Puesta a uno paralela. Con la ayuda de tubos del tipo "sticker operator" se pone de forma paralela a uno el bit N de los 64 tubos.

- Puesta a 0 paralela. Se utiliza también tubos de tipo "stickers operators" de forma paralela sobre los 64 tubos.

Durante el procesamiento, calculan que nunca van a tener más de 96 tubos activos al mismo tiempo, en total se necesita:

* 600 tubos operadores diferentes.
* 63 tubos adiccionales con el operador "separation".
* 522 tubos de sticker para operaciones intermedias.
* 96 tubos de datos, que almacenan variables, etc.

En total se necesitan 1271 tubos y el número de pasos, (unión, división, set o reset) que es necesario para realizar un ataque contra el algoritmo DES es de 6655

Una vez que ha sido realizado el calculo, necesitamos hacer 64 pasos de separación adicionales para leer la contraseña. Naturalmente será necesario hacer un proceso químico de separación PCR para amplificar el resultado del buffer de datos.

¿Cuanto se tarda entonces en romper DES?,

Si tenemos en cuenta que hay que hacer 6655 pasos, más los 64 pasos para hacer la operación, tenemos en total 6719. Depende de como se hagan los pasos.

En el documento de Adleman, hay algunos cálculos:

* Un particular, que lo hace todo a mano, 1 día por operación, en total, 18 años.
* Si la operación tarda 1 hora en realizarse, el ataque dura 9 meses.
* Si usamos un robot paralelo como el descrito, suponiendo 1 minuto por operación, tenemos la clave en 5 horas.

Observe, que cada uno de esos 6655 pasos, es aplicado a todas las combinaciones posibles que pueda existir, por lo tanto, según la cantidad de la llave con la que se encripte, varía la cantidad de líquido necesario.

Para romper el algoritmo DES, usan 140 mililitros de líquido por cada tubo empleado.

Si quieren romper algoritmos que usen claves de mayor tamaño, es lógico pensar que necesitarán más DNA para codificar las soluciones.

He realizado los siguiente cálculos, si DES es de 56 bits, he multiplicado sucesivamente por dos, los 140 mililitros iniciales por cada bit que falta hasta llegar a los 64 bits.

Según mis cálculos, los brazos robots tienen que ser bastante robustos, puesto que tienen que manejar "garrafones" de 35.84 Litros de líquido, y tener capacidad para bastante más.

El número de tubos,por supuesto también se incrementará, aunque no de forma exponencial, y el número de pasos, operaciones a realizar,depende del algoritmo de encriptación, y no del número de bits que se emplee en su encriptación.

Probablemente mis cálculos sean incorrectos, puesto que en esos 140 mililitros, los mismos datos están repetidos millones de veces, si se mete más información, pero con menos repeticiones, hará falta un proceso de amplificación PCR mayor o puede ocurrir que con la química actual no se pueda extraer la solución de una única cadena.

No obstante, si la cantidad de líquido necesario fuese demasiado grande siempre es posible, hacer varios ataques, usando sólo una fracción de los posibles soluciones. E incluso, podría codificarse en una cadena ADN, un buén diccionario de palabras.

7 .- El estado del arte.

Recientemente,hace unos pocos meses, en varios weblogs, hemos podido leer la noticia de que el instituto Weizmann de Israel a construido un autómata finito, ¿similar al sticker de Adleman?, que puede realizar cálculos sencillos, como el detectar si en una secuencia hay tres unos seguidos. Este autómata, puede ser programado y dispone de 765 programas diferentes.

Probablemente, puedan hacer ataques criptográficos. O estén en disposición de poder mejorar su máquina si fuera necesario.

Por otro lado, también hay avances en la química, los sistemas de detección, han sido mejorados:

Laboratorio del sur de California

En esa URL cuentan como es capaz de ser usada incluso para detectar drogas en las aduanas. Por lo tanto, quizá, en lugar de 140 mililitros, por tubo de ensayo, sólo necesiten 50 mililitros.

En la universidad de Wisconsin-Madison, ya no necesitan tubos de ensayo, pues han conseguido transladar el contenido de un tubo de ensayo a la superficie rígida de una placa de cristal y oro. En el experimento que hicieron, metieron en la placa todas las posibles soluciones al problema, y trataron la placa con varias enzimas, las moléculas ADN con las respuestas incorrectas fueron eliminadas.

Un avance como este, unido a un computador similar al que tienen en el laboratorio Weimar, quizás permita dentro de poco fabricar chips que puedan ser insertados en los ordenadores actuales.

En Septiembre de 1999 en la universidad del sur de California el investigador George M. Whitesides ha descubierto nuevas formas de hacer computación DNA. En esta ocasión se trata una tecnología de autoensamblado por "capilaridad lateral", con esta tecnología, se pueden realizar operaciones lógicas XOR.

Actualmente, la computación DNA, se está investigando en prácticamente todas la universidades y laboratorios de los paises avanzados. El documento de Adleman, fué un pistoletazo de salida. Los avances se suceden muy rápidamente, y es posible que en algún laboratorio, tengan algo más avanzado de lo que se dice.

Por lo tanto, en lo que a criptografía se refiere, consideren en subir el tamaño de su llave a 512 bits.

8 .- Bibliografía.

* http://users.aol.com/ibrandt/discover_article.html

Famosa versión en Comic, que todo el mundo cita, apareció en muchas revistas de todo el mundo, su autor es Larry Gonick. Si quereis una versión en castellano, buscar en alguna biblioteca pública números antiguos de la revista "Muy Interesante".

* fp-sci94: Molecular Computation of Solutions To Combinational Problems. Leonard M. Adleman

Describe el experimento de 1994, usando un problema de 6 nodos. El documento, junto a otros del mismo autor, puede ser encontrado en:

http://www-scf.usc.edu/~pwkr/adleman-papers.html
http://www-scf.usc.edu/~pwkr/papers.html

También he usado el documento des.pdf y stickers.pdf

* http://ural.wustl.edu/~slstrick/compgen_pres/sld001.htm

Una exposición, que explica el experimento de 1994.

* http://www.usc.edu/dept/molecular-science/fm-dna-computing-faq.htm

FAQ sobre computación DNA.

* http://www.princeton.edu/~lfl/
* http://www.princeton.edu/~lfl/FRS.html

Página web de Laura Landweber, profesora asociada de la universidad de Princeton, y que es capaz de resolver problemas de ajedrez,con un dispositivo DNA similar al sticker. El segundo enlace, contiene enlaces interesantes.

* http://citeseer.nj.nec.com/adleman-applying.html

Aplicaciones de la tecnología DNA.

* Laboratorio Weizman.

Artículo de un laboratorio israelita que ha construido un computador DNA.

* Comentario del FAQ de PGP

FAQ de PGP traducido al castellano.

* Informática evolutiva - J. J. Merelo Guervós

Es un tutorial sobre algoritmos genéticos.

* http://fce.unl.edu.ar/informatica/nota7.htm

Noticia de un portal universitario Argentino.

* href="http://www.ututo.org.ar/article.php?sid=168

Noticia acerca del computador DNA que está funcionando

* Computadoras con ADN

Boletón de electrónica-itv Número 3. Aquí está la noticia de la Universidad de Winconsin-Madison

* Un ordenador basado en ARN

Boletón de electrónica-itv Número 5

Es probable que me haya dejado algún URL o documento en el tintero.

        Lokutus, asimilando la red.

Fuente:
http://www.hackindex.com/boletin/0402/biocripto.htm

© Copyright 2002  Grupo / A.H.E.



Otras artículos de interés:

PROYECTO DE LEY DE DELITOS INFORMATICOS DE VENEZUELA
Ley Especial Contra los Delitos Informáticos Título I Disposiciones Generales Artículo 1 Objeto de la ley. La presente ley tiene por objeto la protección integral de los sistemas que utilicen tecnolog...
Optimizar protocolos TCP/IP en Ubuntu
Para mejorar significativamente nuestra conexión al navegar/dercarga basta con solo editar el siguiente archivo por consola sudo gedit /etc/sysctl.confAl final del archivo colocar:net.core.rmem_max = 16777216...
VLC-Soundcloud para Debian - Xanadu - Ubuntu - LinuxMint
Como sabemos VLC presenta ciertos problemas técnicos a la hora de conectarse a Playlist de Soundcloud.com, buscando soluciones encontré en ...
Configurar compatibilidad openoffice para Microsoft Office en Ubuntu
Existe un plugin desarrollado por Novel que permite leer y escribir ficheros en el nuevo formato OpenXML usando en Microsoft Office 2007. Descargamos el rpm odf converter desde la web de ...
Instalar Broadcom Wireless Adapter en Ubuntu / LinuxMint
En las últimas laptops en las que he instalado Ubuntu o LinuxMint he presentado problemas con los Broadcom Wireless Adapter, aún cuando la distribución los monta no funcionan... Por lo que hay que hacer lo siguiente:...
IPTRAF monitorea trafico TCP/IP Ubuntu / LinuxMint & Derivados
iptraf es una aplicación que nos muestra en forma detallada el tráfico TCP/IP en tiempo real, además nos genera el informe pertinente. Para instalarlo solo basta hacer: Abrimos consola y escribimos ...
Optimizar Firefox en Ubuntu
Escribir about:config en la barra de navegación: Cambia los siguientes valores: network.http.pipelining true network.http.pipelining.maxrequests 30 network.http.max-connections 96 netwo...
Actualizar al Kernel 3.3.7 en Ubuntu / LinuxMint
Entre las novedades de este Kernel: Mayor Velocidad Mejor Estabilidad Mayor Seguridad Puedes leer más en: ...
Seguridad en WiFi: Pasos básicos para asegurar una WLAN
El propósito de asegurar correctamente un punto de acceso es cortar el paso desde el exterior a nuestra red a personas que no tienen el permiso de entrar. Una red wireless es por definición más difícil de prote...
Aspectos para Auditorías de Sistemas de Información y Tecnologías Informáticas e implementación de estándares de Seguridad Infor
Este documento es una guía práctica para las personas que desean conocer la situación de una organización en relación a su seguridad informática. Conformacíon de la monografía:...

Brindanos
un o una


Redes Sociales

Publicidad


Gana Bitcoins desde tu casa

Categorías


Planeta Vaslibre

Blog Roll




Nube de tags

  • anonimato
  • anonimo
  • antivirus
  • apache
  • bio
  • blog
  • bsd
  • bug
  • centos
  • chrome
  • cifrado
  • computer
  • criptoanalisis
  • debian
  • exploits
  • fedora
  • fice
  • firefox
  • forense
  • freebsd
  • gentoo
  • github
  • gnome
  • gnu
  • gpl
  • gtk
  • hack
  • hacking
  • hosting
  • informatica
  • internet
  • isos
  • libre
  • licencias
  • linux
  • linuxmint
  • lxde
  • micros
  • mint
  • mit
  • mozilla
  • mysql
  • noticia
  • opensource
  • pgp
  • php
  • sabayon
  • seguridad
  • system
  • tecnologia
  • thunar
  • thunderbird
  • tor
  • troyanos
  • tware
  • ubuntu
  • underground
  • vaslibre
  • virus
  • viserproject
  • vivaldi
  • vulnerabilidades
  • web
  • website
  • windows
  • xanadu
  • xfce
  • xombra